Yanz Mini Shell
[_]
[-]
[X]
[
HomeShell 1
] [
HomeShell 2
] [
Upload
] [
Command Shell
] [
Scripting
] [
About
]
[ Directory ] =>
/
home
firstmatrixcoin
public_html
ocean-arc.firstmatrix.co.in
plugins
ckeditor
Action
[*]
New File
[*]
New Folder
Sensitive File
[*]
/etc/passwd
[*]
/etc/shadow
[*]
/etc/resolv.conf
[
Delete
] [
Edit
] [
Rename
] [
Back
]
# Various microbenchmarks comparing unicode and byte string performance # Please keep this file both 2.x and 3.x compatible! import timeit import itertools import operator import re import sys import datetime import optparse VERSION = '2.0' def p(*args): sys.stdout.write(' '.join(str(s) for s in args) + '\n') if sys.version_info >= (3,): BYTES = bytes_from_str = lambda x: x.encode('ascii') UNICODE = unicode_from_str = lambda x: x else: BYTES = bytes_from_str = lambda x: x UNICODE = unicode_from_str = lambda x: x.decode('ascii') class UnsupportedType(TypeError): pass p('stringbench v%s' % VERSION) p(sys.version) p(datetime.datetime.now()) REPEAT = 1 REPEAT = 3 #REPEAT = 7 if __name__ != "__main__": raise SystemExit("Must run as main program") parser = optparse.OptionParser() parser.add_option("-R", "--skip-re", dest="skip_re", action="store_true", help="skip regular expression tests") parser.add_option("-8", "--8-bit", dest="bytes_only", action="store_true", help="only do 8-bit string benchmarks") parser.add_option("-u", "--unicode", dest="unicode_only", action="store_true", help="only do Unicode string benchmarks") _RANGE_1000 = list(range(1000)) _RANGE_100 = list(range(100)) _RANGE_10 = list(range(10)) dups = {} def bench(s, group, repeat_count): def blah(f): if f.__name__ in dups: raise AssertionError("Multiple functions with same name: %r" % (f.__name__,)) dups[f.__name__] = 1 f.comment = s f.is_bench = True f.group = group f.repeat_count = repeat_count return f return blah def uses_re(f): f.uses_re = True ####### 'in' comparisons @bench('"A" in "A"*1000', "early match, single character", 1000) def in_test_quick_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("A") for x in _RANGE_1000: s2 in s1 @bench('"B" in "A"*1000', "no match, single character", 1000) def in_test_no_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("B") for x in _RANGE_1000: s2 in s1 @bench('"AB" in "AB"*1000', "early match, two characters", 1000) def in_test_quick_match_two_characters(STR): s1 = STR("AB" * 1000) s2 = STR("AB") for x in _RANGE_1000: s2 in s1 @bench('"BC" in "AB"*1000', "no match, two characters", 1000) def in_test_no_match_two_character(STR): s1 = STR("AB" * 1000) s2 = STR("BC") for x in _RANGE_1000: s2 in s1 @bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000) def in_test_slow_match_two_characters(STR): s1 = STR("AB" * 300+"C") s2 = STR("BC") for x in _RANGE_1000: s2 in s1 @bench('s="ABC"*33; (s+"E") in ((s+"D")*300+s+"E")', "late match, 100 characters", 100) def in_test_slow_match_100_characters(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = (m+d)*300 + m+e s2 = m+e for x in _RANGE_100: s2 in s1 # Try with regex @uses_re @bench('s="ABC"*33; re.compile(s+"D").search((s+"D")*300+s+"E")', "late match, 100 characters", 100) def re_test_slow_match_100_characters(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = (m+d)*300 + m+e s2 = m+e pat = re.compile(s2) search = pat.search for x in _RANGE_100: search(s1) #### same tests as 'in' but use 'find' @bench('("A"*1000).find("A")', "early match, single character", 1000) def find_test_quick_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("A") s1_find = s1.find for x in _RANGE_1000: s1_find(s2) @bench('("A"*1000).find("B")', "no match, single character", 1000) def find_test_no_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("B") s1_find = s1.find for x in _RANGE_1000: s1_find(s2) @bench('("AB"*1000).find("AB")', "early match, two characters", 1000) def find_test_quick_match_two_characters(STR): s1 = STR("AB" * 1000) s2 = STR("AB") s1_find = s1.find for x in _RANGE_1000: s1_find(s2) @bench('("AB"*1000).find("BC")', "no match, two characters", 1000) def find_test_no_match_two_character(STR): s1 = STR("AB" * 1000) s2 = STR("BC") s1_find = s1.find for x in _RANGE_1000: s1_find(s2) @bench('("AB"*1000).find("CA")', "no match, two characters", 1000) def find_test_no_match_two_character_bis(STR): s1 = STR("AB" * 1000) s2 = STR("CA") s1_find = s1.find for x in _RANGE_1000: s1_find(s2) @bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000) def find_test_slow_match_two_characters(STR): s1 = STR("AB" * 300+"C") s2 = STR("BC") s1_find = s1.find for x in _RANGE_1000: s1_find(s2) @bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000) def find_test_slow_match_two_characters_bis(STR): s1 = STR("AB" * 300+"CA") s2 = STR("CA") s1_find = s1.find for x in _RANGE_1000: s1_find(s2) @bench('s="ABC"*33; ((s+"D")*500+s+"E").find(s+"E")', "late match, 100 characters", 100) def find_test_slow_match_100_characters(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = (m+d)*500 + m+e s2 = m+e s1_find = s1.find for x in _RANGE_100: s1_find(s2) @bench('s="ABC"*33; ((s+"D")*500+"E"+s).find("E"+s)', "late match, 100 characters", 100) def find_test_slow_match_100_characters_bis(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = (m+d)*500 + e+m s2 = e+m s1_find = s1.find for x in _RANGE_100: s1_find(s2) #### Same tests for 'rfind' @bench('("A"*1000).rfind("A")', "early match, single character", 1000) def rfind_test_quick_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("A") s1_rfind = s1.rfind for x in _RANGE_1000: s1_rfind(s2) @bench('("A"*1000).rfind("B")', "no match, single character", 1000) def rfind_test_no_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("B") s1_rfind = s1.rfind for x in _RANGE_1000: s1_rfind(s2) @bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000) def rfind_test_quick_match_two_characters(STR): s1 = STR("AB" * 1000) s2 = STR("AB") s1_rfind = s1.rfind for x in _RANGE_1000: s1_rfind(s2) @bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000) def rfind_test_no_match_two_character(STR): s1 = STR("AB" * 1000) s2 = STR("BC") s1_rfind = s1.rfind for x in _RANGE_1000: s1_rfind(s2) @bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000) def rfind_test_no_match_two_character_bis(STR): s1 = STR("AB" * 1000) s2 = STR("CA") s1_rfind = s1.rfind for x in _RANGE_1000: s1_rfind(s2) @bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000) def rfind_test_slow_match_two_characters(STR): s1 = STR("C" + "AB" * 300) s2 = STR("CA") s1_rfind = s1.rfind for x in _RANGE_1000: s1_rfind(s2) @bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000) def rfind_test_slow_match_two_characters_bis(STR): s1 = STR("BC" + "AB" * 300) s2 = STR("BC") s1_rfind = s1.rfind for x in _RANGE_1000: s1_rfind(s2) @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rfind("E"+s)', "late match, 100 characters", 100) def rfind_test_slow_match_100_characters(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = e+m + (d+m)*500 s2 = e+m s1_rfind = s1.rfind for x in _RANGE_100: s1_rfind(s2) @bench('s="ABC"*33; (s+"E"+("D"+s)*500).rfind(s+"E")', "late match, 100 characters", 100) def rfind_test_slow_match_100_characters_bis(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = m+e + (d+m)*500 s2 = m+e s1_rfind = s1.rfind for x in _RANGE_100: s1_rfind(s2) #### Now with index. # Skip the ones which fail because that would include exception overhead. @bench('("A"*1000).index("A")', "early match, single character", 1000) def index_test_quick_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("A") s1_index = s1.index for x in _RANGE_1000: s1_index(s2) @bench('("AB"*1000).index("AB")', "early match, two characters", 1000) def index_test_quick_match_two_characters(STR): s1 = STR("AB" * 1000) s2 = STR("AB") s1_index = s1.index for x in _RANGE_1000: s1_index(s2) @bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000) def index_test_slow_match_two_characters(STR): s1 = STR("AB" * 300+"C") s2 = STR("BC") s1_index = s1.index for x in _RANGE_1000: s1_index(s2) @bench('s="ABC"*33; ((s+"D")*500+s+"E").index(s+"E")', "late match, 100 characters", 100) def index_test_slow_match_100_characters(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = (m+d)*500 + m+e s2 = m+e s1_index = s1.index for x in _RANGE_100: s1_index(s2) #### Same for rindex @bench('("A"*1000).rindex("A")', "early match, single character", 1000) def rindex_test_quick_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("A") s1_rindex = s1.rindex for x in _RANGE_1000: s1_rindex(s2) @bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000) def rindex_test_quick_match_two_characters(STR): s1 = STR("AB" * 1000) s2 = STR("AB") s1_rindex = s1.rindex for x in _RANGE_1000: s1_rindex(s2) @bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000) def rindex_test_slow_match_two_characters(STR): s1 = STR("C" + "AB" * 300) s2 = STR("CA") s1_rindex = s1.rindex for x in _RANGE_1000: s1_rindex(s2) @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rindex("E"+s)', "late match, 100 characters", 100) def rindex_test_slow_match_100_characters(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = e + m + (d+m)*500 s2 = e + m s1_rindex = s1.rindex for x in _RANGE_100: s1_rindex(s2) #### Same for partition @bench('("A"*1000).partition("A")', "early match, single character", 1000) def partition_test_quick_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("A") s1_partition = s1.partition for x in _RANGE_1000: s1_partition(s2) @bench('("A"*1000).partition("B")', "no match, single character", 1000) def partition_test_no_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("B") s1_partition = s1.partition for x in _RANGE_1000: s1_partition(s2) @bench('("AB"*1000).partition("AB")', "early match, two characters", 1000) def partition_test_quick_match_two_characters(STR): s1 = STR("AB" * 1000) s2 = STR("AB") s1_partition = s1.partition for x in _RANGE_1000: s1_partition(s2) @bench('("AB"*1000).partition("BC")', "no match, two characters", 1000) def partition_test_no_match_two_character(STR): s1 = STR("AB" * 1000) s2 = STR("BC") s1_partition = s1.partition for x in _RANGE_1000: s1_partition(s2) @bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000) def partition_test_slow_match_two_characters(STR): s1 = STR("AB" * 300+"C") s2 = STR("BC") s1_partition = s1.partition for x in _RANGE_1000: s1_partition(s2) @bench('s="ABC"*33; ((s+"D")*500+s+"E").partition(s+"E")', "late match, 100 characters", 100) def partition_test_slow_match_100_characters(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = (m+d)*500 + m+e s2 = m+e s1_partition = s1.partition for x in _RANGE_100: s1_partition(s2) #### Same for rpartition @bench('("A"*1000).rpartition("A")', "early match, single character", 1000) def rpartition_test_quick_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("A") s1_rpartition = s1.rpartition for x in _RANGE_1000: s1_rpartition(s2) @bench('("A"*1000).rpartition("B")', "no match, single character", 1000) def rpartition_test_no_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("B") s1_rpartition = s1.rpartition for x in _RANGE_1000: s1_rpartition(s2) @bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000) def rpartition_test_quick_match_two_characters(STR): s1 = STR("AB" * 1000) s2 = STR("AB") s1_rpartition = s1.rpartition for x in _RANGE_1000: s1_rpartition(s2) @bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000) def rpartition_test_no_match_two_character(STR): s1 = STR("AB" * 1000) s2 = STR("BC") s1_rpartition = s1.rpartition for x in _RANGE_1000: s1_rpartition(s2) @bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000) def rpartition_test_slow_match_two_characters(STR): s1 = STR("C" + "AB" * 300) s2 = STR("CA") s1_rpartition = s1.rpartition for x in _RANGE_1000: s1_rpartition(s2) @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rpartition("E"+s)', "late match, 100 characters", 100) def rpartition_test_slow_match_100_characters(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = e + m + (d+m)*500 s2 = e + m s1_rpartition = s1.rpartition for x in _RANGE_100: s1_rpartition(s2) #### Same for split(s, 1) @bench('("A"*1000).split("A", 1)', "early match, single character", 1000) def split_test_quick_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("A") s1_split = s1.split for x in _RANGE_1000: s1_split(s2, 1) @bench('("A"*1000).split("B", 1)', "no match, single character", 1000) def split_test_no_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("B") s1_split = s1.split for x in _RANGE_1000: s1_split(s2, 1) @bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000) def split_test_quick_match_two_characters(STR): s1 = STR("AB" * 1000) s2 = STR("AB") s1_split = s1.split for x in _RANGE_1000: s1_split(s2, 1) @bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000) def split_test_no_match_two_character(STR): s1 = STR("AB" * 1000) s2 = STR("BC") s1_split = s1.split for x in _RANGE_1000: s1_split(s2, 1) @bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000) def split_test_slow_match_two_characters(STR): s1 = STR("AB" * 300+"C") s2 = STR("BC") s1_split = s1.split for x in _RANGE_1000: s1_split(s2, 1) @bench('s="ABC"*33; ((s+"D")*500+s+"E").split(s+"E", 1)', "late match, 100 characters", 100) def split_test_slow_match_100_characters(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = (m+d)*500 + m+e s2 = m+e s1_split = s1.split for x in _RANGE_100: s1_split(s2, 1) #### Same for rsplit(s, 1) @bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000) def rsplit_test_quick_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("A") s1_rsplit = s1.rsplit for x in _RANGE_1000: s1_rsplit(s2, 1) @bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000) def rsplit_test_no_match_single_character(STR): s1 = STR("A" * 1000) s2 = STR("B") s1_rsplit = s1.rsplit for x in _RANGE_1000: s1_rsplit(s2, 1) @bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000) def rsplit_test_quick_match_two_characters(STR): s1 = STR("AB" * 1000) s2 = STR("AB") s1_rsplit = s1.rsplit for x in _RANGE_1000: s1_rsplit(s2, 1) @bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000) def rsplit_test_no_match_two_character(STR): s1 = STR("AB" * 1000) s2 = STR("BC") s1_rsplit = s1.rsplit for x in _RANGE_1000: s1_rsplit(s2, 1) @bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000) def rsplit_test_slow_match_two_characters(STR): s1 = STR("C" + "AB" * 300) s2 = STR("CA") s1_rsplit = s1.rsplit for x in _RANGE_1000: s1_rsplit(s2, 1) @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rsplit("E"+s, 1)', "late match, 100 characters", 100) def rsplit_test_slow_match_100_characters(STR): m = STR("ABC"*33) d = STR("D") e = STR("E") s1 = e + m + (d+m)*500 s2 = e + m s1_rsplit = s1.rsplit for x in _RANGE_100: s1_rsplit(s2, 1) #### Benchmark the operator-based methods @bench('"A"*10', "repeat 1 character 10 times", 1000) def repeat_single_10_times(STR): s = STR("A") for x in _RANGE_1000: s * 10 @bench('"A"*1000', "repeat 1 character 1000 times", 1000) def repeat_single_1000_times(STR): s = STR("A") for x in _RANGE_1000: s * 1000 @bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000) def repeat_5_10_times(STR): s = STR("ABCDE") for x in _RANGE_1000: s * 10 @bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000) def repeat_5_1000_times(STR): s = STR("ABCDE") for x in _RANGE_1000: s * 1000 # + for concat @bench('"Andrew"+"Dalke"', "concat two strings", 1000) def concat_two_strings(STR): s1 = STR("Andrew") s2 = STR("Dalke") for x in _RANGE_1000: s1+s2 @bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15", 1000) def concat_many_strings(STR): s1=STR('TIXSGYNREDCVBHJ') s2=STR('PUMTLXBZVDO') s3=STR('FVZNJ') s4=STR('OGDXUW') s5=STR('WEIMRNCOYVGHKB') s6=STR('FCQTNMXPUZH') s7=STR('TICZJYRLBNVUEAK') s8=STR('REYB') s9=STR('PWUOQ') s10=STR('EQHCMKBS') s11=STR('AEVDFOH') s12=STR('IFHVD') s13=STR('JGTCNLXWOHQ') s14=STR('ITSKEPYLROZAWXF') s15=STR('THEK') s16=STR('GHPZFBUYCKMNJIT') s17=STR('JMUZ') s18=STR('WLZQMTB') s19=STR('KPADCBW') s20=STR('TNJHZQAGBU') for x in _RANGE_1000: (s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+ s11+s12+s13+s14+s15+s16+s17+s18+s19+s20) #### Benchmark join def get_bytes_yielding_seq(STR, arg): if STR is BYTES and sys.version_info >= (3,): raise UnsupportedType return STR(arg) @bench('"A".join("")', "join empty string, with 1 character sep", 100) def join_empty_single(STR): sep = STR("A") s2 = get_bytes_yielding_seq(STR, "") sep_join = sep.join for x in _RANGE_100: sep_join(s2) @bench('"ABCDE".join("")', "join empty string, with 5 character sep", 100) def join_empty_5(STR): sep = STR("ABCDE") s2 = get_bytes_yielding_seq(STR, "") sep_join = sep.join for x in _RANGE_100: sep_join(s2) @bench('"A".join("ABC..Z")', "join string with 26 characters, with 1 character sep", 1000) def join_alphabet_single(STR): sep = STR("A") s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") sep_join = sep.join for x in _RANGE_1000: sep_join(s2) @bench('"ABCDE".join("ABC..Z")', "join string with 26 characters, with 5 character sep", 1000) def join_alphabet_5(STR): sep = STR("ABCDE") s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") sep_join = sep.join for x in _RANGE_1000: sep_join(s2) @bench('"A".join(list("ABC..Z"))', "join list of 26 characters, with 1 character sep", 1000) def join_alphabet_list_single(STR): sep = STR("A") s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] sep_join = sep.join for x in _RANGE_1000: sep_join(s2) @bench('"ABCDE".join(list("ABC..Z"))', "join list of 26 characters, with 5 character sep", 1000) def join_alphabet_list_five(STR): sep = STR("ABCDE") s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] sep_join = sep.join for x in _RANGE_1000: sep_join(s2) @bench('"A".join(["Bob"]*100))', "join list of 100 words, with 1 character sep", 1000) def join_100_words_single(STR): sep = STR("A") s2 = [STR("Bob")]*100 sep_join = sep.join for x in _RANGE_1000: sep_join(s2) @bench('"ABCDE".join(["Bob"]*100))', "join list of 100 words, with 5 character sep", 1000) def join_100_words_5(STR): sep = STR("ABCDE") s2 = [STR("Bob")]*100 sep_join = sep.join for x in _RANGE_1000: sep_join(s2) #### split tests @bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000) def whitespace_split(STR): s = STR("Here are some words. "*2) s_split = s.split for x in _RANGE_1000: s_split() @bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000) def whitespace_rsplit(STR): s = STR("Here are some words. "*2) s_rsplit = s.rsplit for x in _RANGE_1000: s_rsplit() @bench('("Here are some words. "*2).split(None, 1)', "split 1 whitespace", 1000) def whitespace_split_1(STR): s = STR("Here are some words. "*2) s_split = s.split N = None for x in _RANGE_1000: s_split(N, 1) @bench('("Here are some words. "*2).rsplit(None, 1)', "split 1 whitespace", 1000) def whitespace_rsplit_1(STR): s = STR("Here are some words. "*2) s_rsplit = s.rsplit N = None for x in _RANGE_1000: s_rsplit(N, 1) @bench('("Here are some words. "*2).partition(" ")', "split 1 whitespace", 1000) def whitespace_partition(STR): sep = STR(" ") s = STR("Here are some words. "*2) s_partition = s.partition for x in _RANGE_1000: s_partition(sep) @bench('("Here are some words. "*2).rpartition(" ")', "split 1 whitespace", 1000) def whitespace_rpartition(STR): sep = STR(" ") s = STR("Here are some words. "*2) s_rpartition = s.rpartition for x in _RANGE_1000: s_rpartition(sep) human_text = """\ Python is a dynamic object-oriented programming language that can be used for many kinds of software development. It offers strong support for integration with other languages and tools, comes with extensive standard libraries, and can be learned in a few days. Many Python programmers report substantial productivity gains and feel the language encourages the development of higher quality, more maintainable code. Python runs on Windows, Linux/Unix, Mac OS X, Amiga, Palm Handhelds, and Nokia mobile phones. Python has also been ported to the Java and .NET virtual machines. Python is distributed under an OSI-approved open source license that makes it free to use, even for commercial products. """*25 human_text_bytes = bytes_from_str(human_text) human_text_unicode = unicode_from_str(human_text) def _get_human_text(STR): if STR is UNICODE: return human_text_unicode if STR is BYTES: return human_text_bytes raise AssertionError @bench('human_text.split()', "split whitespace (huge)", 10) def whitespace_split_huge(STR): s = _get_human_text(STR) s_split = s.split for x in _RANGE_10: s_split() @bench('human_text.rsplit()', "split whitespace (huge)", 10) def whitespace_rsplit_huge(STR): s = _get_human_text(STR) s_rsplit = s.rsplit for x in _RANGE_10: s_rsplit() @bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000) def newlines_split(STR): s = STR("this\nis\na\ntest\n") s_split = s.split nl = STR("\n") for x in _RANGE_1000: s_split(nl) @bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000) def newlines_rsplit(STR): s = STR("this\nis\na\ntest\n") s_rsplit = s.rsplit nl = STR("\n") for x in _RANGE_1000: s_rsplit(nl) @bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000) def newlines_splitlines(STR): s = STR("this\nis\na\ntest\n") s_splitlines = s.splitlines for x in _RANGE_1000: s_splitlines() ## split text with 2000 newlines def _make_2000_lines(): import random r = random.Random(100) chars = list(map(chr, range(32, 128))) i = 0 while i < len(chars): chars[i] = " " i += r.randrange(9) s = "".join(chars) s = s*4 words = [] for i in range(2000): start = r.randrange(96) n = r.randint(5, 65) words.append(s[start:start+n]) return "\n".join(words)+"\n" _text_with_2000_lines = _make_2000_lines() _text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines) _text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines) def _get_2000_lines(STR): if STR is UNICODE: return _text_with_2000_lines_unicode if STR is BYTES: return _text_with_2000_lines_bytes raise AssertionError @bench('"...text...".split("\\n")', "split 2000 newlines", 10) def newlines_split_2000(STR): s = _get_2000_lines(STR) s_split = s.split nl = STR("\n") for x in _RANGE_10: s_split(nl) @bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10) def newlines_rsplit_2000(STR): s = _get_2000_lines(STR) s_rsplit = s.rsplit nl = STR("\n") for x in _RANGE_10: s_rsplit(nl) @bench('"...text...".splitlines()', "split 2000 newlines", 10) def newlines_splitlines_2000(STR): s = _get_2000_lines(STR) s_splitlines = s.splitlines for x in _RANGE_10: s_splitlines() ## split text on "--" characters @bench( '"this--is--a--test--of--the--emergency--broadcast--system".split("--")', "split on multicharacter separator (small)", 1000) def split_multichar_sep_small(STR): s = STR("this--is--a--test--of--the--emergency--broadcast--system") s_split = s.split pat = STR("--") for x in _RANGE_1000: s_split(pat) @bench( '"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")', "split on multicharacter separator (small)", 1000) def rsplit_multichar_sep_small(STR): s = STR("this--is--a--test--of--the--emergency--broadcast--system") s_rsplit = s.rsplit pat = STR("--") for x in _RANGE_1000: s_rsplit(pat) ## split dna text on "ACTAT" characters @bench('dna.split("ACTAT")', "split on multicharacter separator (dna)", 10) def split_multichar_sep_dna(STR): s = _get_dna(STR) s_split = s.split pat = STR("ACTAT") for x in _RANGE_10: s_split(pat) @bench('dna.rsplit("ACTAT")', "split on multicharacter separator (dna)", 10) def rsplit_multichar_sep_dna(STR): s = _get_dna(STR) s_rsplit = s.rsplit pat = STR("ACTAT") for x in _RANGE_10: s_rsplit(pat) ## split with limits GFF3_example = "\t".join([ "I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".", "ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"]) @bench('GFF3_example.split("\\t")', "tab split", 1000) def tab_split_no_limit(STR): sep = STR("\t") s = STR(GFF3_example) s_split = s.split for x in _RANGE_1000: s_split(sep) @bench('GFF3_example.split("\\t", 8)', "tab split", 1000) def tab_split_limit(STR): sep = STR("\t") s = STR(GFF3_example) s_split = s.split for x in _RANGE_1000: s_split(sep, 8) @bench('GFF3_example.rsplit("\\t")', "tab split", 1000) def tab_rsplit_no_limit(STR): sep = STR("\t") s = STR(GFF3_example) s_rsplit = s.rsplit for x in _RANGE_1000: s_rsplit(sep) @bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000) def tab_rsplit_limit(STR): sep = STR("\t") s = STR(GFF3_example) s_rsplit = s.rsplit for x in _RANGE_1000: s_rsplit(sep, 8) #### Count characters @bench('...text.with.2000.newlines.count("\\n")', "count newlines", 10) def count_newlines(STR): s = _get_2000_lines(STR) s_count = s.count nl = STR("\n") for x in _RANGE_10: s_count(nl) # Orchid sequences concatenated, from Biopython _dna = """ CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC """ _dna = "".join(_dna.splitlines()) _dna = _dna * 25 _dna_bytes = bytes_from_str(_dna) _dna_unicode = unicode_from_str(_dna) def _get_dna(STR): if STR is UNICODE: return _dna_unicode if STR is BYTES: return _dna_bytes raise AssertionError @bench('dna.count("AACT")', "count AACT substrings in DNA example", 10) def count_aact(STR): seq = _get_dna(STR) seq_count = seq.count needle = STR("AACT") for x in _RANGE_10: seq_count(needle) ##### startswith and endswith @bench('"Andrew".startswith("A")', 'startswith single character', 1000) def startswith_single(STR): s1 = STR("Andrew") s2 = STR("A") s1_startswith = s1.startswith for x in _RANGE_1000: s1_startswith(s2) @bench('"Andrew".startswith("Andrew")', 'startswith multiple characters', 1000) def startswith_multiple(STR): s1 = STR("Andrew") s2 = STR("Andrew") s1_startswith = s1.startswith for x in _RANGE_1000: s1_startswith(s2) @bench('"Andrew".startswith("Anders")', 'startswith multiple characters - not!', 1000) def startswith_multiple_not(STR): s1 = STR("Andrew") s2 = STR("Anders") s1_startswith = s1.startswith for x in _RANGE_1000: s1_startswith(s2) # endswith @bench('"Andrew".endswith("w")', 'endswith single character', 1000) def endswith_single(STR): s1 = STR("Andrew") s2 = STR("w") s1_endswith = s1.endswith for x in _RANGE_1000: s1_endswith(s2) @bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000) def endswith_multiple(STR): s1 = STR("Andrew") s2 = STR("Andrew") s1_endswith = s1.endswith for x in _RANGE_1000: s1_endswith(s2) @bench('"Andrew".endswith("Anders")', 'endswith multiple characters - not!', 1000) def endswith_multiple_not(STR): s1 = STR("Andrew") s2 = STR("Anders") s1_endswith = s1.endswith for x in _RANGE_1000: s1_endswith(s2) #### Strip @bench('"Hello!\\n".strip()', 'strip terminal newline', 1000) def terminal_newline_strip_right(STR): s = STR("Hello!\n") s_strip = s.strip for x in _RANGE_1000: s_strip() @bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000) def terminal_newline_rstrip(STR): s = STR("Hello!\n") s_rstrip = s.rstrip for x in _RANGE_1000: s_rstrip() @bench('"\\nHello!".strip()', 'strip terminal newline', 1000) def terminal_newline_strip_left(STR): s = STR("\nHello!") s_strip = s.strip for x in _RANGE_1000: s_strip() @bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000) def terminal_newline_strip_both(STR): s = STR("\nHello!\n") s_strip = s.strip for x in _RANGE_1000: s_strip() @bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000) def terminal_newline_lstrip(STR): s = STR("\nHello!") s_lstrip = s.lstrip for x in _RANGE_1000: s_lstrip() @bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s', 'strip terminal newline', 1000) def terminal_newline_if_else(STR): s = STR("Hello!\n") NL = STR("\n") for x in _RANGE_1000: s[:-1] if (s[-1] == NL) else s # Strip multiple spaces or tabs @bench('"Hello\\t \\t".strip()', 'strip terminal spaces and tabs', 1000) def terminal_space_strip(STR): s = STR("Hello\t \t!") s_strip = s.strip for x in _RANGE_1000: s_strip() @bench('"Hello\\t \\t".rstrip()', 'strip terminal spaces and tabs', 1000) def terminal_space_rstrip(STR): s = STR("Hello!\t \t") s_rstrip = s.rstrip for x in _RANGE_1000: s_rstrip() @bench('"\\t \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000) def terminal_space_lstrip(STR): s = STR("\t \tHello!") s_lstrip = s.lstrip for x in _RANGE_1000: s_lstrip() #### replace @bench('"This is a test".replace(" ", "\\t")', 'replace single character', 1000) def replace_single_character(STR): s = STR("This is a test!") from_str = STR(" ") to_str = STR("\t") s_replace = s.replace for x in _RANGE_1000: s_replace(from_str, to_str) @uses_re @bench('re.sub(" ", "\\t", "This is a test"', 'replace single character', 1000) def replace_single_character_re(STR): s = STR("This is a test!") pat = re.compile(STR(" ")) to_str = STR("\t") pat_sub = pat.sub for x in _RANGE_1000: pat_sub(to_str, s) @bench('"...text.with.2000.lines...replace("\\n", " ")', 'replace single character, big string', 10) def replace_single_character_big(STR): s = _get_2000_lines(STR) from_str = STR("\n") to_str = STR(" ") s_replace = s.replace for x in _RANGE_10: s_replace(from_str, to_str) @uses_re @bench('re.sub("\\n", " ", "...text.with.2000.lines...")', 'replace single character, big string', 10) def replace_single_character_big_re(STR): s = _get_2000_lines(STR) pat = re.compile(STR("\n")) to_str = STR(" ") pat_sub = pat.sub for x in _RANGE_10: pat_sub(to_str, s) @bench('dna.replace("ATC", "ATT")', 'replace multiple characters, dna', 10) def replace_multiple_characters_dna(STR): seq = _get_dna(STR) from_str = STR("ATC") to_str = STR("ATT") seq_replace = seq.replace for x in _RANGE_10: seq_replace(from_str, to_str) # This increases the character count @bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")', 'replace and expand multiple characters, big string', 10) def replace_multiple_character_big(STR): s = _get_2000_lines(STR) from_str = STR("\n") to_str = STR("\r\n") s_replace = s.replace for x in _RANGE_10: s_replace(from_str, to_str) # This decreases the character count @bench('"When shall we three meet again?".replace("ee", "")', 'replace/remove multiple characters', 1000) def replace_multiple_character_remove(STR): s = STR("When shall we three meet again?") from_str = STR("ee") to_str = STR("") s_replace = s.replace for x in _RANGE_1000: s_replace(from_str, to_str) big_s = "A" + ("Z"*128*1024) big_s_bytes = bytes_from_str(big_s) big_s_unicode = unicode_from_str(big_s) def _get_big_s(STR): if STR is UNICODE: return big_s_unicode if STR is BYTES: return big_s_bytes raise AssertionError # The older replace implementation counted all matches in # the string even when it only needed to make one replacement. @bench('("A" + ("Z"*128*1024)).replace("A", "BB", 1)', 'quick replace single character match', 10) def quick_replace_single_match(STR): s = _get_big_s(STR) from_str = STR("A") to_str = STR("BB") s_replace = s.replace for x in _RANGE_10: s_replace(from_str, to_str, 1) @bench('("A" + ("Z"*128*1024)).replace("AZZ", "BBZZ", 1)', 'quick replace multiple character match', 10) def quick_replace_multiple_match(STR): s = _get_big_s(STR) from_str = STR("AZZ") to_str = STR("BBZZ") s_replace = s.replace for x in _RANGE_10: s_replace(from_str, to_str, 1) #### # CCP does a lot of this, for internationalisation of ingame messages. _format = "The %(thing)s is %(place)s the %(location)s." _format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", } _format_bytes = bytes_from_str(_format) _format_unicode = unicode_from_str(_format) _format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items()) _format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items()) def _get_format(STR): if STR is UNICODE: return _format_unicode if STR is BYTES: if sys.version_info >= (3,): raise UnsupportedType return _format_bytes raise AssertionError def _get_format_dict(STR): if STR is UNICODE: return _format_dict_unicode if STR is BYTES: if sys.version_info >= (3,): raise UnsupportedType return _format_dict_bytes raise AssertionError # Formatting. @bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}', 'formatting a string type with a dict', 1000) def format_with_dict(STR): s = _get_format(STR) d = _get_format_dict(STR) for x in _RANGE_1000: s % d #### Upper- and lower- case conversion @bench('("Where in the world is Carmen San Deigo?"*10).lower()', "case conversion -- rare", 1000) def lower_conversion_rare(STR): s = STR("Where in the world is Carmen San Deigo?"*10) s_lower = s.lower for x in _RANGE_1000: s_lower() @bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()', "case conversion -- dense", 1000) def lower_conversion_dense(STR): s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10) s_lower = s.lower for x in _RANGE_1000: s_lower() @bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()', "case conversion -- rare", 1000) def upper_conversion_rare(STR): s = STR("Where in the world is Carmen San Deigo?"*10) s_upper = s.upper for x in _RANGE_1000: s_upper() @bench('("where in the world is carmen san deigo?"*10).upper()', "case conversion -- dense", 1000) def upper_conversion_dense(STR): s = STR("where in the world is carmen san deigo?"*10) s_upper = s.upper for x in _RANGE_1000: s_upper() # end of benchmarks ################# class BenchTimer(timeit.Timer): def best(self, repeat=1): for i in range(1, 10): number = 10**i x = self.timeit(number) if x > 0.02: break times = [x] for i in range(1, repeat): times.append(self.timeit(number)) return min(times) / number def main(): (options, test_names) = parser.parse_args() if options.bytes_only and options.unicode_only: raise SystemExit("Only one of --8-bit and --unicode are allowed") bench_functions = [] for (k,v) in globals().items(): if hasattr(v, "is_bench"): if test_names: for name in test_names: if name in v.group: break else: # Not selected, ignore continue if options.skip_re and hasattr(v, "uses_re"): continue bench_functions.append( (v.group, k, v) ) bench_functions.sort() p("bytes\tunicode") p("(in ms)\t(in ms)\t%\tcomment") bytes_total = uni_total = 0.0 for title, group in itertools.groupby(bench_functions, operator.itemgetter(0)): # Flush buffer before each group sys.stdout.flush() p("="*10, title) for (_, k, v) in group: if hasattr(v, "is_bench"): bytes_time = 0.0 bytes_time_s = " - " if not options.unicode_only: try: bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,), "import __main__").best(REPEAT) bytes_time_s = "%.2f" % (1000 * bytes_time) bytes_total += bytes_time except UnsupportedType: bytes_time_s = "N/A" uni_time = 0.0 uni_time_s = " - " if not options.bytes_only: try: uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,), "import __main__").best(REPEAT) uni_time_s = "%.2f" % (1000 * uni_time) uni_total += uni_time except UnsupportedType: uni_time_s = "N/A" try: average = bytes_time/uni_time except (TypeError, ZeroDivisionError): average = 0.0 p("%s\t%s\t%.1f\t%s (*%d)" % ( bytes_time_s, uni_time_s, 100.*average, v.comment, v.repeat_count)) if bytes_total == uni_total == 0.0: p("That was zippy!") else: try: ratio = bytes_total/uni_total except ZeroDivisionError: ratio = 0.0 p("%.2f\t%.2f\t%.1f\t%s" % ( 1000*bytes_total, 1000*uni_total, 100.*ratio, "TOTAL")) if __name__ == "__main__": main()
Free Space : 60954562560 Byte